Gsdmd Antibody

Lab Reagents

Human IgG antibody Laboratories manufactures the gsdmd antibody reagents distributed by Genprice. The Gsdmd Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Gsdmd products are available in stock. Specificity: Gsdmd Category: Antibody

Chemicals information

Anti-GSDMD antibody

STJ11100237 100 µl
EUR 277
Description: Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described.

Anti-GSDMD antibody

STJ112203 100 µl
EUR 277
Description: Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described.

Anti-GSDMD antibody

STJ119438 100 µl
EUR 277
Description: Gasdermin D is a member of the gasdermin family. Members of this family appear to play a role in regulation of epithelial proliferation. Gasdermin D has been suggested to act as a tumor suppressor. Alternatively spliced transcript variants have been described.

GSDMD siRNA

20-abx918778
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Gasdermin D (GSDMD) Antibody

20-abx112681
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gasdermin D (GSDMD) Antibody

20-abx136074
  • EUR 411.00
  • EUR 105.00
  • EUR 592.00
  • EUR 182.00
  • 100 ul
  • 10 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

GSDMD Polyclonal Conjugated Antibody

C30013 100ul
EUR 397

GSDMD Polyclonal Conjugated Antibody

C30392 100ul
EUR 397

GSDMD Antibody, HRP conjugated

1-CSB-PA009956LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSDMD. Recognizes GSDMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSDMD Antibody, FITC conjugated

1-CSB-PA009956LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSDMD. Recognizes GSDMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSDMD Antibody, Biotin conjugated

1-CSB-PA009956LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSDMD. Recognizes GSDMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Gasdermin D (GSDMD) Antibody

abx340202-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gasdermin D (GSDMD) Antibody

abx233670-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gasdermin D (GSDMD) Antibody

20-abx302637
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSDMD Blocking Peptide

DF12275-BP 1mg
EUR 195

GSDMD cloning plasmid

CSB-CL009956HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: atggggtcggcctttgagcgggtagtccggagagtggtccaggagctggaccatggtggggagttcatccctgtgaccagcctgcagagctccactggcttccagccctactgcctggtggttaggaagccctcaagctcatggttctggaaaccccgttataagtgtgtcaacc
  • Show more
Description: A cloning plasmid for the GSDMD gene.

GSDMD Rabbit pAb

A18281-100ul 100 ul
EUR 308