Reagecon-1060525 Sds

Lab Reagents

Human IgG antibody Laboratories manufactures the reagecon-1060525 sds reagents distributed by Genprice. The Reagecon-1060525 Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Reagecon Inc.. Other Reagecon-1060525 products are available in stock. Specificity: Reagecon-1060525 Category: Sds

Chemicals information

10% SDS

TG4060 1ml
EUR 134


YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover


100G SDS Ultrapure

NAT1072 100G
EUR 93