A guide for studying among-individual behavioral variation from movement data in the wild

animal tracking and recording devices Biologging large amounts of data on the behavior of individual movements in a natural environment. In these data, the ecology movement often see the explained variation around the mean as the “voice” when studying the pattern on a population level. In the field of behavioral ecology, however, the focus has shifted from how the population to the biological underpinnings of variation around the mean.

special measures, behavioral ecologists use the repetitive behaviors of individuals to partition the variability of behavior becomes intrinsically between-individual variation and plasticity of behavior is reversible and to measure: a) individual variation in the types of behavior (ie the average expression of the different behaviors), b) individual variation in plasticity of behavior (ie response different from individual to environmental gradients), c) individual variation in predictability of behavior (ie residual different in every individual variability in behavior around the mean), and d) the correlation between these components and correlations in behavioral suite, called ‘behavioral syndrome.

We here show that variability partition behavior in the animal movement will be the integration of the ecological movement with fields of behavioral ecology. We provide a review of the literature shows that individual differences in the behavior of a profound movement for wildlife and conservation studies and provide recommendations regarding the data required to handle these questions. In our R accompanying tutorial provides guidance on statistical approaches to measure different aspects of among-individual variation.

We use the data movement from the 35 African elephants and shows that elephants are different in a) their behavior on average for the three behaviors general movement, b) the degree to which they adjusted more movement gradient temporal, and c) the predictability of their behavior (ranging from more to individual less predictable). Finally, two of the three behaviors that correlate movement into behavioral syndromes (d), the individual moves further has an average residence time is short.

While not explicitly tested here, the individual differences in movement and predictability can affect an individual’s risk can be hunted or poached and therefore the new road is open for conservation biologists to assess the feasibility of the population. We hope that this review, tutorials, and examples will encourage ecological movement worked to examine the biology of individual variation in the movements of animals hidden behind the population mean.

 A guide for studying among-individual behavioral variation from movement data in the wild
A guide for studying among-individual behavioral variation from movement data in the wild

A long-term dataset on the abundance of wild bees in the Mid-Atlantic United States

With the global downturn documented in insects, including wild bees, there has been increased interest in developing and expanding insect monitoring program. Our goal here is to manage, validate, and share the analysis-ready version of one of several existing datasets for the long term monitoring of wild bees in the United States.

Since 1999, the original Bee Inventory and Monitoring Lab (BIML) of the United States Geological Survey has samples of wild-bee community in the Mid-Atlantic US, but samples collected in several studies and datasets are not fully integrated. Furthermore, important information about the sampling methodology is often lacking, even though these factors can significantly affect the results of the collection and must be considered in the analysis.

Anti-OXR1 antibody

PAab06053 100 ug
EUR 355

Anti-Oxr1 antibody

STJ94846 200 µl
EUR 197
Description: Rabbit polyclonal to Oxr1.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Oxr1 Antibody

AF9148 200ul
EUR 304
Description: Oxr1 Antibody detects endogenous levels of total Oxr1.

Oxr1 Antibody

ABF9148 100 ug
EUR 438

OXR1 antibody

70R-4383 50 ug
EUR 467
Description: Rabbit polyclonal OXR1 antibody raised against the N terminal of OXR1

OXR1 Antibody

34885-100ul 100ul
EUR 252

OXR1 Antibody

34885-50ul 50ul
EUR 187

OXR1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

OXR1 Antibody

CSB-PA971107-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

OXR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

OXR1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Polyclonal OXR1 Antibody

APR05465G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OXR1 . This antibody is tested and proven to work in the following applications:

OXR1 Conjugated Antibody

C34885 100ul
EUR 397

Oxr1 Polyclonal Antibody

ES6704-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Oxr1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Oxr1 Polyclonal Antibody

ES6704-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Oxr1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Oxr1 Polyclonal Antibody

ABP55705-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Oxr1 from Human, Mouse, Rat. This Oxr1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530

Oxr1 Polyclonal Antibody

ABP55705-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Oxr1 from Human, Mouse, Rat. This Oxr1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530

Oxr1 Polyclonal Antibody

ABP55705-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Oxr1 from Human, Mouse, Rat. This Oxr1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Oxr1 at AA range: 450-530

OXR1 Polyclonal Antibody

A60150 100 µg
EUR 570.55
Description: reagents widely cited


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OXR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OXR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OXR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against OXR1. Recognizes OXR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Oxr1 Blocking Peptide

AF9148-BP 1mg
EUR 195

OXR1 Blocking Peptide

33R-9512 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OXR1 antibody, catalog no. 70R-4383

OXR1 cloning plasmid

CSB-CL854043HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atgtcttttcagaaacctaaagggactattgagtatactgttgaatcaagggattctttgaatagcatagccctgaagtttgatacaacacctaacgaacttgttcaattaaataagttattctcccgagcagttgttactggacaggttctgtatgttcctgatcctgaatatg
  • Show more
Description: A cloning plasmid for the OXR1 gene.

OXR1 Polyclonal Antibody, Biotin Conjugated

A60151 100 µg
EUR 570.55
Description: Ask the seller for details

OXR1 Polyclonal Antibody, FITC Conjugated

A60152 100 µg
EUR 570.55
Description: The best epigenetics products

OXR1 Polyclonal Antibody, HRP Conjugated

A60153 100 µg
EUR 570.55
Description: kits suitable for this type of research

Oxidation Resistance Protein 1 (OXR1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Oxidation resistance protein 1 (OXR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxidation resistance protein 1 (OXR1) Antibody

abx331382-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Oxidation Resistance Protein 1 (OXR1) Antibody

abx236053-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Oxidation Resistance Protein 1 (OXR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse OXR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat OXR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001483 96 Tests
EUR 689

Human OXR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pENTR223-OXR1-G3T vector

PVT11778 2 ug
EUR 304

Oxidation Resistance Protein 1 (OXR1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxidation Resistance Protein 1 (OXR1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxidation Resistance Protein 1 (OXR1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

OXR1 ORF Vector (Human) (pORF)

ORF007443 1.0 ug DNA
EUR 95

Oxr1 ORF Vector (Rat) (pORF)

ORF073008 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Rat) (pORF)

ORF073009 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Rat) (pORF)

ORF073010 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Mouse) (pORF)

ORF053240 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Mouse) (pORF)

ORF053241 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Mouse) (pORF)

ORF053242 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Mouse) (pORF)

ORF053243 1.0 ug DNA
EUR 506

Oxr1 ORF Vector (Mouse) (pORF)

ORF053244 1.0 ug DNA
EUR 506

OXR1 ELISA Kit (Mouse) (OKEH06502)

OKEH06502 96 Wells
EUR 662
Description: Description of target: May be involved in protection from oxidative damage. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.317 ng/mL

OXR1 ELISA Kit (Human) (OKEH06568)

OKEH06568 96 Wells
EUR 662
Description: Description of target: May be involved in protection from oxidative damage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.327 ng/mL

OXR1 sgRNA CRISPR Lentivector set (Human)

K1580601 3 x 1.0 ug
EUR 339

Oxr1 sgRNA CRISPR Lentivector set (Mouse)

K4479901 3 x 1.0 ug
EUR 339

Oxr1 sgRNA CRISPR Lentivector set (Rat)

K6981001 3 x 1.0 ug
EUR 339

OXR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1580602 1.0 ug DNA
EUR 154

OXR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1580603 1.0 ug DNA
EUR 154

OXR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1580604 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4479902 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4479903 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4479904 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6981002 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6981003 1.0 ug DNA
EUR 154

Oxr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6981004 1.0 ug DNA
EUR 154

Human Oxidation Resistance 1(OXR1)ELISA Kit

QY-E02095 96T
EUR 361

OXR1 Protein Vector (Human) (pPB-C-His)

PV029769 500 ng
EUR 329

OXR1 Protein Vector (Human) (pPB-N-His)

PV029770 500 ng
EUR 329

OXR1 Protein Vector (Human) (pPM-C-HA)

PV029771 500 ng
EUR 329

OXR1 Protein Vector (Human) (pPM-C-His)

PV029772 500 ng
EUR 329

OXR1 Protein Vector (Mouse) (pPB-C-His)

PV212958 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-N-His)

PV212959 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-HA)

PV212960 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-His)

PV212961 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-C-His)

PV212962 500 ng
EUR 603

OXR1 Protein Vector (Mouse) (pPB-N-His)

PV212963 500 ng
EUR 603

OXR1 Protein Vector (Mouse) (pPM-C-HA)

PV212964 500 ng
EUR 603

OXR1 Protein Vector (Mouse) (pPM-C-His)

PV212965 500 ng
EUR 603

OXR1 Protein Vector (Mouse) (pPB-C-His)

PV212966 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-N-His)

PV212967 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-HA)

PV212968 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-His)

PV212969 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-C-His)

PV212970 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-N-His)

PV212971 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-HA)

PV212972 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-His)

PV212973 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-C-His)

PV212974 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPB-N-His)

PV212975 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-HA)

PV212976 500 ng
EUR 1065

OXR1 Protein Vector (Mouse) (pPM-C-His)

PV212977 500 ng
EUR 1065

OXR1 Protein Vector (Rat) (pPB-C-His)

PV292030 500 ng
EUR 603

OXR1 Protein Vector (Rat) (pPB-N-His)

PV292031 500 ng
EUR 603

OXR1 Protein Vector (Rat) (pPM-C-HA)

PV292032 500 ng
EUR 603

OXR1 Protein Vector (Rat) (pPM-C-His)

PV292033 500 ng
EUR 603

OXR1 Protein Vector (Rat) (pPB-C-His)

PV292034 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPB-N-His)

PV292035 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPM-C-HA)

PV292036 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPM-C-His)

PV292037 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPB-C-His)

PV292038 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPB-N-His)

PV292039 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPM-C-HA)

PV292040 500 ng
EUR 1191

OXR1 Protein Vector (Rat) (pPM-C-His)

PV292041 500 ng
EUR 1191

Oxr1 3'UTR GFP Stable Cell Line

TU165801 1.0 ml Ask for price

OXR1 3'UTR Luciferase Stable Cell Line

TU017240 1.0 ml
EUR 1521

Oxr1 3'UTR Luciferase Stable Cell Line

TU115801 1.0 ml Ask for price

OXR1 3'UTR GFP Stable Cell Line

TU067240 1.0 ml
EUR 1521

Oxr1 3'UTR GFP Stable Cell Line

TU265715 1.0 ml Ask for price

Oxr1 3'UTR Luciferase Stable Cell Line

TU215715 1.0 ml Ask for price

Cow Oxidation resistance protein 1 (OXR1) ELISA Kit

abx555750-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Human Oxidation resistance protein 1 (OXR1) ELISA Kit

abx555933-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Oxidation resistance protein 1 (Oxr1) ELISA Kit

abx555939-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Oxidation resistance protein 1 (Oxr1) ELISA Kit

abx556205-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Oxr1/ Oxidation resistance protein 1 ELISA Kit

E1088Mo 1 Kit
EUR 632

Human OXR1/ Oxidation resistance protein 1 ELISA Kit

E1848Hu 1 Kit
EUR 605

Rat Oxidation resistance protein 1, Oxr1 ELISA KIT

ELI-12415r 96 Tests
EUR 886

Bovine Oxidation resistance protein 1, OXR1 ELISA KIT

ELI-14544b 96 Tests
EUR 928

Human Oxidation resistance protein 1, OXR1 ELISA KIT

ELI-22095h 96 Tests
EUR 824

Mouse Oxidation resistance protein 1, Oxr1 ELISA KIT

ELI-44304m 96 Tests
EUR 865

OXR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV699175 1.0 ug DNA
EUR 514

OXR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV699179 1.0 ug DNA
EUR 514

OXR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV699180 1.0 ug DNA
EUR 514

OXR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV699187 1.0 ug DNA
EUR 1355

OXR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV699191 1.0 ug DNA
EUR 1355

OXR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV699192 1.0 ug DNA
EUR 1355

OXR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV699193 1.0 ug DNA
EUR 1355

OXR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV699197 1.0 ug DNA
EUR 1355

OXR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV699198 1.0 ug DNA
EUR 1355

Recombinant Candida Albicans OXR1 Protein (aa 1-345)

VAng-Lsx05785-1mgEcoli 1 mg (E. coli)
EUR 4394
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Oxidation resistance protein 1, recombinant protein.

Recombinant Candida Albicans OXR1 Protein (aa 1-345)

VAng-Lsx05785-500gEcoli 500 µg (E. coli)
EUR 3115
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Oxidation resistance protein 1, recombinant protein.

Recombinant Candida Albicans OXR1 Protein (aa 1-345)

VAng-Lsx05785-50gEcoli 50 µg (E. coli)
EUR 2126
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Oxidation resistance protein 1, recombinant protein.

Oxr1 ELISA Kit| Rat Oxidation resistance protein 1 ELISA Kit

EF019121 96 Tests
EUR 689

Oxr1 ELISA Kit| Mouse Oxidation resistance protein 1 ELISA Kit

EF015772 96 Tests
EUR 689

OXR1 ELISA Kit| Bovine Oxidation resistance protein 1 ELISA Kit

EF011704 96 Tests
EUR 689

OXR1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1580605 3 x 1.0 ug
EUR 376

Oxr1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4479905 3 x 1.0 ug
EUR 376

Oxr1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6981005 3 x 1.0 ug
EUR 376

OXR1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1580606 1.0 ug DNA
EUR 167

OXR1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1580607 1.0 ug DNA
EUR 167

OXR1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1580608 1.0 ug DNA
EUR 167

We cleaned and verified the data BIML of Maryland, Delaware, and Washington DC, USA, and the resulting sample methodology for more than 84% of the 99 053 pan-trapped events in this region. We enthusiastically invite creative analysis of this rich dataset to advance understanding of the biology and ecology of wild bees, inform conservation efforts, and may help design a national monitoring program bees.