Molecular Species Delimitation of the Genus Reishia (Mollusca: Gastropoda) along the Coasts of China and Korea

Species of the genus gastropod predator Reishia Kuroda and Habe, 1971 (Muricidae) inhabits the intertidal rocky shore in East Asia. Shell varies greatly because of their external morphology, taxonomy of this genus to species-level is still in need of re-evaluation. Using DNA-based methods of delimitation, we aim to ensure Reishia number of species along the coast of China and Asia adjacent areas.

Also, we look for the characteristics of the diagnostic uses a statistical approach based on morphology. Our genetic data indicate that individuals learn consists of two separate species of complex Reishia in this region, in contrast to previously proposed four or more taxa. This conclusion is further supported by statistical analysis of the morphological characteristics of the shell. The morphospecies R. bronni (Dunker, 1860), R. jubilaea (Tan and Sigurdsson, 1990), and R. luteostoma (Holten, 1803) is assigned to a single taxon, suggesting that they may be synonyms of the same species.

The morphospecies R. clavigera (Kuster, 1860) individually formed one group, shows that there is a possibility that a valid name. estimated time of divergence of the two taxa were identified indicates that speciation may have been linked to sea level and temperature fluctuations during the Plio-Pleistocene period. Our study on the species Reishia provide important information for further research on ecology, evolutionary biology, and conservation of this genus.

Gut microbial communities play an important role in the health of the host, modulating the development, acquisition nutrition, immunity and regulation of metabolism, behavior and disease. Wildlife studies microbiome and host-microbe interactions and exploration may be an important goal for evolutionary biology, conservation, and ecology.

Therefore, the collection and sampling methods should be considered before choosing a plan based microbiome research. Because the microbial community of fecal intestinal reflects society really better than cloacal swab samples and only a few nondestructive methods have been described, we propose a simple box build for noninvasive stool collection method. The main components of the collection box plastic storage boxes, trays, plastic, vinyl-coated hardware cloth, and a 10% bleach solution.

 Molecular Species Delimitation of the Genus Reishia (Mollusca: Gastropoda) along the Coasts of China and Korea
Molecular Species Delimitation of the Genus Reishia (Mollusca: Gastropoda) along the Coasts of China and Korea

Bacteria Annual Impact Epizootics in Albatross population on a remote island

Reducing species richness typical oceanic islands provide an attractive environment settings to check in natura dynamics of the epidemiology of infectious agents with potential implications for the health and / or public conservation. In Amsterdam Island (Indian Ocean), repetitive die-off of Indian yellow-nosed albatross (Thalassarche carteri) nestlings have been associated with fowl cholera, which is caused by the bacterium Pasteurella multocida.

In order to help implement efficient measures to control this disease, it is important to better understand the local epidemiology of P. multocida infections and examine the dynamics of inter and intra-annual. We evaluate the infection status of 264 yellow-nosed albatross over four breeding seasons in a row using real-time PCR targeting the DNA of P. multocida cloacal swabs. Infection prevalence patterns reveal the intense circulation of P. multocida whole survey, with a steady increase in the prevalence of infection but variable in each breeding season.

Anti-S100A3 antibody

STJ25430 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has the highest content of cysteines of all S100 proteins, has a high affinity for Zinc, and is highly expressed in human hair cuticle. The precise function of this protein is unknown.


YF-PA24646 50 ul
EUR 334
Description: Mouse polyclonal to S100A3

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-S100A3 (1D4)

YF-MA15308 100 ug
EUR 363
Description: Mouse monoclonal to S100A3

S100A3 Antibody

ABD13246 100 ug
EUR 438

S100A3 Antibody

ABD4354 100 ug
EUR 438

S100A3 antibody

70R-20062 50 ul
EUR 435
Description: Rabbit polyclonal S100A3 antibody

S100A3 antibody

70R-1096 100 ug
EUR 377
Description: Rabbit polyclonal S100A3 antibody raised against the N terminal of S100A3

S100A3 Antibody

DF4354 200ul
EUR 304
Description: S100A3 Antibody detects endogenous levels of total S100A3.

S100A3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

S100A3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

S100A3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

S100A3 Polyclonal Antibody

30520-100ul 100ul
EUR 252

S100A3 Polyclonal Antibody

30520-50ul 50ul
EUR 187

Human S100A3 antibody

32880-05111 150 ug
EUR 261

S100a3/ Rat S100a3 ELISA Kit

ELI-38732r 96 Tests
EUR 886

S100A3 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S100A3 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

S100A3 Protein

  • EUR 328.00
  • EUR 6341.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

S100A3 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S100A3 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

S100A3 Polyclonal Conjugated Antibody

C30520 100ul
EUR 397

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

S100A3 cloning plasmid

CSB-CL020631HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atggccaggcctctggagcaggcggtagctgccatcgtgtgcaccttccaggaatacgcagggcgctgtggggacaaatacaagctctgccaggcggagctcaaggagctgctgcagaaggagctggccacctggaccccgactgagtttcgggaatgtgactacaacaaattcat
  • Show more
Description: A cloning plasmid for the S100A3 gene.

S100A3 Rabbit pAb

A4102-100ul 100 ul
EUR 308

S100A3 Rabbit pAb

A4102-200ul 200 ul
EUR 459

S100A3 Rabbit pAb

A4102-20ul 20 ul
EUR 183

S100A3 Rabbit pAb

A4102-50ul 50 ul
EUR 223

S100A3 Blocking Peptide

33R-5733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of S100A3 antibody, catalog no. 70R-1096

S100A3 Blocking Peptide

DF4354-BP 1mg
EUR 195


PVT13675 2 ug
EUR 391

Human S100A3 antibody (Biotin Conjugate)

32880-05121 150 ug
EUR 369

Polyclonal S100A3 / S100E Antibody (aa26-75)

AMM07707G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 / S100E (aa26-75). This antibody is tested and proven to work in the following applications:

Polyclonal S100A3 antibody - N-terminal region

AMM07718G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Human S100A3 AssayLite Antibody (FITC Conjugate)

32880-05141 150 ug
EUR 428

Human S100A3 AssayLite Antibody (RPE Conjugate)

32880-05151 150 ug
EUR 428

Human S100A3 AssayLite Antibody (APC Conjugate)

32880-05161 150 ug
EUR 428

Human S100A3 AssayLite Antibody (PerCP Conjugate)

32880-05171 150 ug
EUR 471

Rat S100A3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

S100A3 ELISA KIT|Human

EF002690 96 Tests
EUR 689

Human S100A3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

S100A3 protein (His tag)

80R-1834 100 ug
EUR 305
Description: Purified recombinant S100A3 protein

S100A3 protein (His tag)

80R-2395 100 ug
EUR 322
Description: Purified recombinant Mouse S100A3 protein (His tag)

Mouse S100A3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal S100A3 Antibody (monoclonal) (M01), Clone: 1D4

AMM07708G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human S100A3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D4. This antibody is applicable in WB

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody

abx237559-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Protein S100-A3 (S100A3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein S100-A3(S100A3) expressed in E.coli

S100A3 ORF Vector (Human) (pORF)

ORF009167 1.0 ug DNA
EUR 95

S100a3 ORF Vector (Mouse) (pORF)

ORF056605 1.0 ug DNA
EUR 506

S100a3 ORF Vector (Rat) (pORF)

ORF075787 1.0 ug DNA
EUR 506

S100 Calcium Binding Protein A3 (S100A3) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

S100A3 sgRNA CRISPR Lentivector set (Human)

K2082401 3 x 1.0 ug
EUR 339

S100a3 sgRNA CRISPR Lentivector set (Mouse)

K3420501 3 x 1.0 ug
EUR 339

S100a3 sgRNA CRISPR Lentivector set (Rat)

K7113101 3 x 1.0 ug
EUR 339

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3)

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3)

Human Protein S100- A3, S100A3 ELISA KIT

ELI-53357h 96 Tests
EUR 824

Mouse Protein S100- A3, S100a3 ELISA KIT

ELI-41458m 96 Tests
EUR 865

S100A3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2082402 1.0 ug DNA
EUR 154

S100A3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2082403 1.0 ug DNA
EUR 154

S100A3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2082404 1.0 ug DNA
EUR 154

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3420502 1.0 ug DNA
EUR 154

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3420503 1.0 ug DNA
EUR 154

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3420504 1.0 ug DNA
EUR 154

Human Protein S100-A3(S100A3) ELISA kit

CSB-EL020631HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3 (S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein S100-A3(S100A3) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3(S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7113102 1.0 ug DNA
EUR 154

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7113103 1.0 ug DNA
EUR 154

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7113104 1.0 ug DNA
EUR 154

S100A3 Protein Vector (Human) (pPB-C-His)

PV036665 500 ng
EUR 329

S100A3 Protein Vector (Human) (pPB-N-His)

PV036666 500 ng
EUR 329

S100A3 Protein Vector (Human) (pPM-C-HA)

PV036667 500 ng
EUR 329

S100A3 Protein Vector (Human) (pPM-C-His)

PV036668 500 ng
EUR 329

Recombinant S100 Calcium Binding Protein A3 (S100A3)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P33764
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human S100 Calcium Binding Protein A3 expressed in: E.coli

Recombinant S100 Calcium Binding Protein A3 (S100A3)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62819
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat S100 Calcium Binding Protein A3 expressed in: E.coli

Recombinant Mouse S100A3 Protein, His, E.coli-1mg

QP13393-1mg 1mg
EUR 2757

Recombinant Mouse S100A3 Protein, His, E.coli-20ug

QP13393-20ug 20ug
EUR 201

Recombinant Mouse S100A3 Protein, His, E.coli-5ug

QP13393-5ug 5ug
EUR 155

S100A3 Protein Vector (Rat) (pPB-C-His)

PV303146 500 ng
EUR 603

S100A3 Protein Vector (Rat) (pPB-N-His)

PV303147 500 ng
EUR 603

S100A3 Protein Vector (Rat) (pPM-C-HA)

PV303148 500 ng
EUR 603

S100A3 Protein Vector (Rat) (pPM-C-His)

PV303149 500 ng
EUR 603

S100A3 Protein Vector (Mouse) (pPB-C-His)

PV226418 500 ng
EUR 603

S100A3 Protein Vector (Mouse) (pPB-N-His)

PV226419 500 ng
EUR 603

S100A3 Protein Vector (Mouse) (pPM-C-HA)

PV226420 500 ng
EUR 603

S100A3 Protein Vector (Mouse) (pPM-C-His)

PV226421 500 ng
EUR 603

S100a3 3'UTR GFP Stable Cell Line

TU168292 1.0 ml Ask for price

S100A3 3'UTR Luciferase Stable Cell Line

TU022520 1.0 ml
EUR 1394

S100a3 3'UTR Luciferase Stable Cell Line

TU118292 1.0 ml Ask for price

S100A3 3'UTR GFP Stable Cell Line

TU072520 1.0 ml
EUR 1394

S100a3 3'UTR Luciferase Stable Cell Line

TU219873 1.0 ml Ask for price

S100a3 3'UTR GFP Stable Cell Line

TU269873 1.0 ml Ask for price

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3)

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

Rat S100 Calcium Binding Protein A3 (S100A3) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human S100 Calcium Binding Protein A3 (S100A3) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

S100A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695767 1.0 ug DNA
EUR 514

S100A3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695771 1.0 ug DNA
EUR 514

S100A3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695772 1.0 ug DNA
EUR 514

S100A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792745 1.0 ug DNA
EUR 316

S100A3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792746 1.0 ug DNA
EUR 316

Recombinant Human S100A3/ S100E Protein, GST, E.coli-100ug

QP6638-ec-100ug 100ug
EUR 408

Recombinant Human S100A3/ S100E Protein, GST, E.coli-10ug

QP6638-ec-10ug 10ug
EUR 200

Recombinant Human S100A3/ S100E Protein, GST, E.coli-1mg

QP6638-ec-1mg 1mg
EUR 1632

Recombinant Human S100A3/ S100E Protein, GST, E.coli-200ug

QP6638-ec-200ug 200ug
EUR 634

Recombinant Human S100A3/ S100E Protein, GST, E.coli-500ug

QP6638-ec-500ug 500ug
EUR 1060

Recombinant Human S100A3/ S100E Protein, GST, E.coli-50ug

QP6638-ec-50ug 50ug
EUR 263

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~Gln101
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

Human S100 Calcium Binding Protein A3 (S100A3) ELISA Kit

abx383005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

S100A3 S100 Calcium Binding Protein A3 Human Recombinant Protein

PROTP33764 Regular: 10ug
EUR 317
Description: S100A3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 121 amino acids (1-101) and having a molecular mass of 13.9kDa.;The S100A3 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

S100A3 S100 Calcium Binding Protein A3 Mouse Recombinant Protein

PROTP62818 Regular: 20ug
EUR 317
Description: S100A3 Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-101 a.a) and having a molecular mass of 14.3kDa.;S100A3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: S100A3 (Met1~Gln101)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2082405 3 x 1.0 ug
EUR 376

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3420505 3 x 1.0 ug
EUR 376

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7113105 3 x 1.0 ug
EUR 376

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2082406 1.0 ug DNA
EUR 167

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2082407 1.0 ug DNA
EUR 167

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2082408 1.0 ug DNA
EUR 167

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3420506 1.0 ug DNA
EUR 167

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3420507 1.0 ug DNA
EUR 167

This epizootics associated with large curled die-off, pushing the fledging success is very low (≤ 20%). These results show significant variations in the dynamics of transmission of these pathogens. These findings and the PCR protocol developed have direct applications to guide future research plans and conservation aimed at controlling the disease flute.