Molecular Species Delimitation of the Genus Reishia (Mollusca: Gastropoda) along the Coasts of China and Korea

Species of the genus gastropod predator Reishia Kuroda and Habe, 1971 (Muricidae) inhabits the intertidal rocky shore in East Asia. Shell varies greatly because of their external morphology, taxonomy of this genus to species-level is still in need of re-evaluation. Using DNA-based methods of delimitation, we aim to ensure Reishia number of species along the coast of China and Asia adjacent areas.

Also, we look for the characteristics of the diagnostic uses a statistical approach based on morphology. Our genetic data indicate that individuals learn consists of two separate species of complex Reishia in this region, in contrast to previously proposed four or more taxa. This conclusion is further supported by statistical analysis of the morphological characteristics of the shell. The morphospecies R. bronni (Dunker, 1860), R. jubilaea (Tan and Sigurdsson, 1990), and R. luteostoma (Holten, 1803) is assigned to a single taxon, suggesting that they may be synonyms of the same species.

The morphospecies R. clavigera (Kuster, 1860) individually formed one group, shows that there is a possibility that a valid name. estimated time of divergence of the two taxa were identified indicates that speciation may have been linked to sea level and temperature fluctuations during the Plio-Pleistocene period. Our study on the species Reishia provide important information for further research on ecology, evolutionary biology, and conservation of this genus.

Gut microbial communities play an important role in the health of the host, modulating the development, acquisition nutrition, immunity and regulation of metabolism, behavior and disease. Wildlife studies microbiome and host-microbe interactions and exploration may be an important goal for evolutionary biology, conservation, and ecology.

Therefore, the collection and sampling methods should be considered before choosing a plan based microbiome research. Because the microbial community of fecal intestinal reflects society really better than cloacal swab samples and only a few nondestructive methods have been described, we propose a simple box build for noninvasive stool collection method. The main components of the collection box plastic storage boxes, trays, plastic, vinyl-coated hardware cloth, and a 10% bleach solution.

Bacteria Annual Impact Epizootics in Albatross population on a remote island

Reducing species richness typical oceanic islands provide an attractive environment settings to check in natura dynamics of the epidemiology of infectious agents with potential implications for the health and / or public conservation. In Amsterdam Island (Indian Ocean), repetitive die-off of Indian yellow-nosed albatross (Thalassarche carteri) nestlings have been associated with fowl cholera, which is caused by the bacterium Pasteurella multocida.

In order to help implement efficient measures to control this disease, it is important to better understand the local epidemiology of P. multocida infections and examine the dynamics of inter and intra-annual. We evaluate the infection status of 264 yellow-nosed albatross over four breeding seasons in a row using real-time PCR targeting the DNA of P. multocida cloacal swabs. Infection prevalence patterns reveal the intense circulation of P. multocida whole survey, with a steady increase in the prevalence of infection but variable in each breeding season.

Anti-S100A3 antibody
STJ25430	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has the highest content of cysteines of all S100 proteins, has a high affinity for Zinc, and is highly expressed in human hair cuticle. The precise function of this protein is unknown.

anti-S100A3
YF-PA24646	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to S100A3

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349.00

Anti-S100A3 (1D4)
YF-MA15308	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to S100A3

S100A3 Antibody
1-CSB-PA020631ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

S100A3 Antibody
1-CSB-PA020631GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

S100A3 Antibody
1-CSB-PA040284	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against S100A3. Recognizes S100A3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

S100A3 antibody
70R-20062	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal S100A3 antibody

S100A3 Antibody
DF4354	Affbiotech	200ul	EUR 304.00
Description: S100A3 Antibody detects endogenous levels of total S100A3.

S100A3 Antibody
ABD13246	Lifescience Market	100 ug	EUR 438.00

S100A3 Antibody
ABD4354	Lifescience Market	100 ug	EUR 438.00

S100A3 antibody
70R-1096	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal S100A3 antibody raised against the N terminal of S100A3

Human S100A3 antibody
32880-05111	AssayPro	150 ug	EUR 261.00

S100A3 Polyclonal Antibody
30520-100ul	SAB	100ul	EUR 252.00

S100A3 Polyclonal Antibody
30520-50ul	SAB	50ul	EUR 187.00

S100a3/ Rat S100a3 ELISA Kit
ELI-38732r	Lifescience Market	96 Tests	EUR 886.00

S100A3 Protein
20-abx261704	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

S100A3 siRNA
20-abx904755	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

S100A3 Protein
20-abx262343	Abbexa	EUR 328.00 EUR 6341.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

S100A3 siRNA
20-abx932350	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

S100A3 siRNA
20-abx932351	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

S100A3 Polyclonal Conjugated Antibody
C30520	SAB	100ul	EUR 397.00

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280.00

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280.00

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280.00

S100A3 cloning plasmid
CSB-CL020631HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 306 Sequence: atggccaggcctctggagcaggcggtagctgccatcgtgtgcaccttccaggaatacgcagggcgctgtggggacaaatacaagctctgccaggcggagctcaaggagctgctgcagaaggagctggccacctggaccccgactgagtttcgggaatgtgactacaacaaattcat Show more
Description: A cloning plasmid for the S100A3 gene.

S100A3 Blocking Peptide
33R-5733	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of S100A3 antibody, catalog no. 70R-1096

S100A3 Rabbit pAb
A4102-100ul	Abclonal	100 ul	EUR 308.00

S100A3 Rabbit pAb
A4102-200ul	Abclonal	200 ul	EUR 459.00

S100A3 Rabbit pAb
A4102-20ul	Abclonal	20 ul	EUR 183.00

S100A3 Rabbit pAb
A4102-50ul	Abclonal	50 ul	EUR 223.00

S100A3 Blocking Peptide
DF4354-BP	Affbiotech	1mg	EUR 195.00

pCMV-SPORT6-S100A3
PVT13675	Lifescience Market	2 ug	EUR 391.00

Human S100A3 antibody (Biotin Conjugate)
32880-05121	AssayPro	150 ug	EUR 369.00

Polyclonal S100A3 / S100E Antibody (aa26-75)
AMM07707G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 / S100E (aa26-75). This antibody is tested and proven to work in the following applications:

Polyclonal S100A3 antibody - N-terminal region
AMM07718G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human S100A3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Human S100A3 AssayLite Antibody (FITC Conjugate)
32880-05141	AssayPro	150 ug	EUR 428.00

Human S100A3 AssayLite Antibody (RPE Conjugate)
32880-05151	AssayPro	150 ug	EUR 428.00

Human S100A3 AssayLite Antibody (APC Conjugate)
32880-05161	AssayPro	150 ug	EUR 428.00

Human S100A3 AssayLite Antibody (PerCP Conjugate)
32880-05171	AssayPro	150 ug	EUR 471.00

Rat S100A3 shRNA Plasmid
20-abx987183	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human S100A3 shRNA Plasmid
20-abx954222	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse S100A3 shRNA Plasmid
20-abx972550	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

S100A3 protein (His tag)
80R-1834	Fitzgerald	100 ug	EUR 305.00
Description: Purified recombinant S100A3 protein

S100A3 protein (His tag)
80R-2395	Fitzgerald	100 ug	EUR 322.00
Description: Purified recombinant Mouse S100A3 protein (His tag)

S100A3 ELISA KIT|Human
EF002690	Lifescience Market	96 Tests	EUR 689.00

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx103516	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx103517	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx132056	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx115361	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Monoclonal S100A3 Antibody (monoclonal) (M01), Clone: 1D4
AMM07708G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human S100A3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D4. This antibody is applicable in WB

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx003019	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx014754	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx326589	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
20-abx320480	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody
abx237559-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Human Protein S100-A3 (S100A3)
1-CSB-EP020631HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein S100-A3(S100A3) expressed in E.coli

S100A3 ORF Vector (Human) (pORF)
ORF009167	ABM	1.0 ug DNA	EUR 95.00

S100a3 ORF Vector (Mouse) (pORF)
ORF056605	ABM	1.0 ug DNA	EUR 506.00

S100a3 ORF Vector (Rat) (pORF)
ORF075787	ABM	1.0 ug DNA	EUR 506.00

S100 Calcium Binding Protein A3 (S100A3) Antibody (Biotin)
20-abx272459	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

S100 Calcium Binding Protein A3 (S100A3) Antibody (Biotin)
20-abx273332	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

S100A3 sgRNA CRISPR Lentivector set (Human)
K2082401	ABM	3 x 1.0 ug	EUR 339.00

S100a3 sgRNA CRISPR Lentivector set (Rat)
K7113101	ABM	3 x 1.0 ug	EUR 339.00

S100a3 sgRNA CRISPR Lentivector set (Mouse)
K3420501	ABM	3 x 1.0 ug	EUR 339.00

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat)
4-PAC015Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3)

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human)
4-MAC015Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3)

Human Protein S100-A3(S100A3) ELISA kit
CSB-EL020631HU-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3 (S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein S100-A3(S100A3) ELISA kit
1-CSB-EL020631HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein S100-A3(S100A3) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein S100- A3, S100A3 ELISA KIT
ELI-53357h	Lifescience Market	96 Tests	EUR 824.00

Mouse Protein S100- A3, S100a3 ELISA KIT
ELI-41458m	Lifescience Market	96 Tests	EUR 865.00

S100A3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2082402	ABM	1.0 ug DNA	EUR 154.00

S100A3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2082403	ABM	1.0 ug DNA	EUR 154.00

S100A3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2082404	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7113102	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7113103	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7113104	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3420502	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3420503	ABM	1.0 ug DNA	EUR 154.00

S100a3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3420504	ABM	1.0 ug DNA	EUR 154.00

S100A3 Protein Vector (Rat) (pPB-C-His)
PV303146	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Rat) (pPB-N-His)
PV303147	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Rat) (pPM-C-HA)
PV303148	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Rat) (pPM-C-His)
PV303149	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Mouse) (pPB-C-His)
PV226418	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Mouse) (pPB-N-His)
PV226419	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Mouse) (pPM-C-HA)
PV226420	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Mouse) (pPM-C-His)
PV226421	ABM	500 ng	EUR 603.00

S100A3 Protein Vector (Human) (pPB-C-His)
PV036665	ABM	500 ng	EUR 329.00

S100A3 Protein Vector (Human) (pPB-N-His)
PV036666	ABM	500 ng	EUR 329.00

S100A3 Protein Vector (Human) (pPM-C-HA)
PV036667	ABM	500 ng	EUR 329.00

S100A3 Protein Vector (Human) (pPM-C-His)
PV036668	ABM	500 ng	EUR 329.00

Recombinant Mouse S100A3 Protein, His, E.coli-1mg
QP13393-1mg	EnQuireBio	1mg	EUR 2757.00

Recombinant Mouse S100A3 Protein, His, E.coli-20ug
QP13393-20ug	EnQuireBio	20ug	EUR 201.00

Recombinant Mouse S100A3 Protein, His, E.coli-5ug
QP13393-5ug	EnQuireBio	5ug	EUR 155.00

S100a3 3'UTR Luciferase Stable Cell Line
TU118292	ABM	1.0 ml	Ask for price

S100A3 3'UTR Luciferase Stable Cell Line
TU022520	ABM	1.0 ml	EUR 1394.00

S100a3 3'UTR GFP Stable Cell Line
TU168292	ABM	1.0 ml	Ask for price

Recombinant S100 Calcium Binding Protein A3 (S100A3)
4-RPC015Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P33764 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.4kDa Isoelectric Point: Inquire
Description: Recombinant Human S100 Calcium Binding Protein A3 expressed in: E.coli

Recombinant S100 Calcium Binding Protein A3 (S100A3)
4-RPC015Ra01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P62819 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.2kDa Isoelectric Point: Inquire
Description: Recombinant Rat S100 Calcium Binding Protein A3 expressed in: E.coli

S100A3 3'UTR GFP Stable Cell Line
TU072520	ABM	1.0 ml	EUR 1394.00

S100a3 3'UTR Luciferase Stable Cell Line
TU219873	ABM	1.0 ml	Ask for price

S100a3 3'UTR GFP Stable Cell Line
TU269873	ABM	1.0 ml	Ask for price

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse)
4-PAC015Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3)

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), APC
4-PAC015Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), Biotinylated
4-PAC015Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), Cy3
4-PAC015Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), FITC
4-PAC015Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), HRP
4-PAC015Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), PE
4-PAC015Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), APC
4-MAC015Hu21-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), Biotinylated
4-MAC015Hu21-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), Cy3
4-MAC015Hu21-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), FITC
4-MAC015Hu21-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), HRP
4-MAC015Hu21-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), PE
4-MAC015Hu21-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

Rat S100 Calcium Binding Protein A3 (S100A3) Protein
20-abx068958	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human S100 Calcium Binding Protein A3 (S100A3) Protein
20-abx068959	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

S100A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792745	ABM	1.0 ug DNA	EUR 316.00

S100A3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792746	ABM	1.0 ug DNA	EUR 316.00

S100A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695767	ABM	1.0 ug DNA	EUR 514.00

S100A3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695771	ABM	1.0 ug DNA	EUR 514.00

S100A3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695772	ABM	1.0 ug DNA	EUR 514.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-100ug
QP6638-ec-100ug	EnQuireBio	100ug	EUR 408.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-10ug
QP6638-ec-10ug	EnQuireBio	10ug	EUR 200.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-1mg
QP6638-ec-1mg	EnQuireBio	1mg	EUR 1632.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-200ug
QP6638-ec-200ug	EnQuireBio	200ug	EUR 634.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-500ug
QP6638-ec-500ug	EnQuireBio	500ug	EUR 1060.00

Recombinant Human S100A3/ S100E Protein, GST, E.coli-50ug
QP6638-ec-50ug	EnQuireBio	50ug	EUR 263.00

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), APC
4-PAC015Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC015Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Biotin.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC015Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with Cy3.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), FITC
4-PAC015Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with FITC.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), HRP
4-PAC015Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with HRP.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), PE
4-PAC015Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with PE.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Rat), APC-Cy7
4-PAC015Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

S100 Calcium Binding Protein A3 (S100A3) Monoclonal Antibody (Human), APC-Cy7
4-MAC015Hu21-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Met1~Gln101 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

Human S100 Calcium Binding Protein A3 (S100A3) ELISA Kit
abx383005-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

S100A3 S100 Calcium Binding Protein A3 Mouse Recombinant Protein
PROTP62818	BosterBio	Regular: 20ug	EUR 317.00
Description: S100A3 Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-101 a.a) and having a molecular mass of 14.3kDa.;S100A3 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

S100A3 S100 Calcium Binding Protein A3 Human Recombinant Protein
PROTP33764	BosterBio	Regular: 10ug	EUR 317.00
Description: S100A3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 121 amino acids (1-101) and having a molecular mass of 13.9kDa.;The S100A3 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

S100 Calcium Binding Protein A3 (S100A3) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC015Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: S100A3 (Met1~Gln101) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse S100 Calcium Binding Protein A3 (S100A3). This antibody is labeled with APC-Cy7.

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2082405	ABM	3 x 1.0 ug	EUR 376.00

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7113105	ABM	3 x 1.0 ug	EUR 376.00

S100a3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3420505	ABM	3 x 1.0 ug	EUR 376.00

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2082406	ABM	1.0 ug DNA	EUR 167.00

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2082407	ABM	1.0 ug DNA	EUR 167.00

S100A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2082408	ABM	1.0 ug DNA	EUR 167.00

S100A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV695768	ABM	1.0 ug DNA	EUR 514.00

S100A3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV695769	ABM	1.0 ug DNA	EUR 572.00

This epizootics associated with large curled die-off, pushing the fledging success is very low (≤ 20%). These results show significant variations in the dynamics of transmission of these pathogens. These findings and the PCR protocol developed have direct applications to guide future research plans and conservation aimed at controlling the disease flute.